pLX_HA-C7orf26v1
(Plasmid #178535)

• Purpose: Subcloned C7orf26v1 (ENST00000344417, Origene, RC219786L4) into pLX_HA backbone
• Depositing Lab: William Hahn
• Publication: Pan et al Cell Syst. 2022 Jan 21. pii: S2405-4712(21)00488-9. doi: 10.1016/j.cels.2021.12.005.

Backbone

• Vector backbone: pLX_HA
• Backbone size w/o insert (bp): 8409
• Total vector size (bp): 9748
• Modifications to backbone: c-term HA on backbone
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: C7orf26v1
• Alt name: ENST00000359073
• Species: H. sapiens (human); Human
• Insert Size (bp): 1339
• GenBank ID: NM_024067.4
• Entrez Gene: INTS15 (a.k.a. C7orf26)
• Promoter: EF1a
• Tag / Fusion Protein:
  • HA (C terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pLX_HA - pDONR221 - RC219786 extraction PCR Product Entry clone Expression clone.gb
• A portion of this plasmid was derived from a plasmid made by: C7orf26v1 from Origene (ENST00000344417, Origene, RC219786L4)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry