Skip to main content
Addgene

pLX_HA
(Plasmid #178534)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178534 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLX_TRC317 (https://portals.broadinstitute.org/gpp/public/vector/details?vector=pLX_TRC317)
  • Backbone size (bp) 8409
  • Modifications to backbone
    c-term HA on backbone instead of V5
  • Vector type
    Mammalian Expression
  • Promoter EF1a
  • Selectable markers
    Puromycin
  • Tag / Fusion Protein
    • HA (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • 5′ sequencing primer EF1a-F (TCAAGCCTCAGACAGTGGTTC)
  • 3′ sequencing primer WPRE-R (CATAGCGTAAAAGGAGCAACA)
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX_HA was a gift from William Hahn (Addgene plasmid # 178534 ; http://n2t.net/addgene:178534 ; RRID:Addgene_178534)

  • For your References section:

    Sparse dictionary learning recovers pleiotropy from human cell fitness screens. Pan J, Kwon JJ, Talamas JA, Borah AA, Vazquez F, Boehm JS, Tsherniak A, Zitnik M, McFarland JM, Hahn WC. Cell Syst. 2022 Jan 21. pii: S2405-4712(21)00488-9. doi: 10.1016/j.cels.2021.12.005. 10.1016/j.cels.2021.12.005 PubMed 35085500
Related items:
Commonly requested with: