pFUW-TetO-IRF5
(Plasmid
#178450)
-
Purposedoxycycline-inducible expression of Human IRF5 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178450 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFUW-TetO
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIRF5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1497
-
GenBank IDNM_032643.4
-
Entrez GeneIRF5 (a.k.a. SLEB10)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site BstBI (unknown if destroyed)
- 5′ sequencing primer TCCACGCTGTTTTGACCTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUW-TetO-IRF5 was a gift from Filipe Pereira (Addgene plasmid # 178450 ; http://n2t.net/addgene:178450 ; RRID:Addgene_178450) -
For your References section:
Single-cell transcriptional profiling informs efficient reprogramming of human somatic cells to cross-presenting dendritic cells. Rosa FF, Pires CF, Kurochkin I, Halitzki E, Zahan T, Arh N, Zimmermannova O, Ferreira AG, Li H, Karlsson S, Scheding S, Pereira CF. Sci Immunol. 2022 Mar 4;7(69):eabg5539. doi: 10.1126/sciimmunol.abg5539. Epub 2022 Mar 4. 10.1126/sciimmunol.abg5539 PubMed 35245086