Skip to main content
Addgene

pFUW-TetO-CREM
(Plasmid #178442)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178442 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFUW-TetO
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CREM
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    414
  • GenBank ID
    BC017117.1
  • Entrez Gene
    CREM (a.k.a. CREM-2, ICER, hCREM-2)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BstBI (unknown if destroyed)
  • 5′ sequencing primer TCCACGCTGTTTTGACCTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid encodes human CREM isoform 2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUW-TetO-CREM was a gift from Filipe Pereira (Addgene plasmid # 178442 ; http://n2t.net/addgene:178442 ; RRID:Addgene_178442)
  • For your References section:

    Single-cell transcriptional profiling informs efficient reprogramming of human somatic cells to cross-presenting dendritic cells. Rosa FF, Pires CF, Kurochkin I, Halitzki E, Zahan T, Arh N, Zimmermannova O, Ferreira AG, Li H, Karlsson S, Scheding S, Pereira CF. Sci Immunol. 2022 Mar 4;7(69):eabg5539. doi: 10.1126/sciimmunol.abg5539. Epub 2022 Mar 4. 10.1126/sciimmunol.abg5539 PubMed 35245086