pcS-pep1-C1C2
(Plasmid
#178428)
-
Purposepep1 as cell penetrating peptide fused to EV membrane binging domain (C1C2)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonedownsized pcDNA backbone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepep1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AATGTGTCGAGCCACTGGGC
- 3′ sequencing primer AGCATAATCTGGAACATCATATGGATAGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcS-pep1-C1C2 was a gift from Masako Harada (Addgene plasmid # 178428 ; http://n2t.net/addgene:178428 ; RRID:Addgene_178428) -
For your References section:
Engineering Extracellular Vesicles to Target Pancreatic Tissue In Vivo. Komuro H, Kawai-Harada Y, Aminova S, Pascual N, Malik A, Contag CH, Harada M. Nanotheranostics. 2021 Apr 15;5(4):378-390. doi: 10.7150/ntno.54879. eCollection 2021. 10.7150/ntno.54879 PubMed 33912378