pCI-T7Max-UTR1-deGFP-8xHis-T500
(Plasmid #178422)

• Purpose: Expression of deGFP via a T7 Promoter in TXTL
• Depositing Lab: Kate Adamala
• Publication: Deich et al J Biol Eng. 2023 Jan 23;17(1):4. doi: 10.1186/s13036-023-00323-1.

Backbone

• Vector backbone: PCI
• Backbone size w/o insert (bp): 2800
• Total vector size (bp): 3593
• Modifications to backbone: promoter, RBS, MCS and terminator replaced. BsaI sites removed from the whole backbone.
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: deGFP
• Species: Synthetic
• Insert Size (bp): 719
• Promoter: T7Max
• Tag / Fusion Protein:
  • 8xHis Tag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: TTTTGCTCACATGGCTCG
• 3′ sequencing primer: CCCCCTGAACCTGAAACATA

Resource Information

• Supplemental Documents:
  • pci-t7max-utr1-degfp-8xhis-t500.gb
• A portion of this plasmid was derived from a plasmid made by: Vincent Noireaux Lab
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.10.17.464727v1 for bioRxiv preprint.