-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 1784 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSP-108
- Backbone size w/o insert (bp) 9439
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesiTwist
-
Alt namesiRNA Twist
-
Alt namemTwist
-
Alt nameTwist
-
SpeciesM. musculus (mouse)
-
GenBank IDM63649
-
Entrez GeneTwist1 (a.k.a. M-Twist, Pde, Ska10, Ska<m10Jus>, Twist, bHLHa38, pdt)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstBI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer na (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEmpty pSP108 vector can be obtained from Dr. Eric Fearson, Univ of Michigan
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Twist-siRNA3-targetting sequence is AAGCTGAGCAAGATTCAGACC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Twist-siRNA3 was a gift from Bob Weinberg (Addgene plasmid # 1784 ; http://n2t.net/addgene:1784 ; RRID:Addgene_1784) -
For your References section:
Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, Savagner P, Gitelman I, Richardson A, Weinberg RA. Cell 2004 Jun 25;117(7):927-39. 10.1016/j.cell.2004.06.006 PubMed 15210113