Skip to main content
Addgene

pCAX-mScarlet-FBP17
(Plasmid #178366)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178366 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAX
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Formin Binding Protein 17
  • Alt name
    FBP17
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1851
  • Mutation
    400 Glutamic Acid changed to Aspartic acid (403 A to C)
  • Entrez Gene
    FNBP1 (a.k.a. FBP17)
  • Promoter Chicken Beta Actin

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGCTCCTGGGCAACGTGC
  • 3′ sequencing primer CACTCGGAAGGACATATGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAX-mScarlet-FBP17 was a gift from Erik Dent (Addgene plasmid # 178366 ; http://n2t.net/addgene:178366 ; RRID:Addgene_178366)
  • For your References section:

    Opposing functions of F-BAR proteins in neuronal membrane protrusion, tubule formation, and neurite outgrowth. Taylor KL, Taylor RJ, Richters KE, Huynh B, Carrington J, McDermott ME, Wilson RL, Dent EW. Life Sci Alliance. 2019 Jun 3;2(3). pii: 2/3/e201800288. doi: 10.26508/lsa.201800288. Print 2019 Jun. 10.26508/lsa.201800288 PubMed 31160379