pCAX-mScarlet-CIP4
(Plasmid #178364)

• Purpose: Expresses CIP4 c-terminal labeled with mScarlet in mammalian cells
• Depositing Lab: Erik Dent
• Publication: Taylor et al Life Sci Alliance. 2019 Jun 3;2(3). pii: 2/3/e201800288. doi: 10.26508/lsa.201800288. Print 2019 Jun.

Backbone

• Vector backbone: pCAX
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 7058
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cdc42 Interacting Protein 4
• Alt name: CIP4
• Species: H. sapiens (human)
• Insert Size (bp): 1635
• Entrez Gene: TRIP10 (a.k.a. CIP4, HSTP, STOT, STP, TRIP-10)
• Promoter: CAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGCTCCTGGGCAACGTGC
• 3′ sequencing primer: CACTCGGAAGGACATATGGG

Resource Information

• Supplemental Documents:
  • 347-pcax-cip4-mscarlet.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry