Skip to main content
Addgene

ER-CanlonicSF
(Plasmid #178343)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178343 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCMV-myc-ER
  • Backbone manufacturer
    Thermo Scientific
  • Backbone size w/o insert (bp) 5051
  • Total vector size (bp) 6806
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ER-CanlonicSF
  • Alt name
    ER Targeted Calcium-and-Lactate Optical Nano-Indicator from CECs Single Fluorophore
  • Species
    Synthetic
  • Insert Size (bp)
    1755
  • Promoter CMV
  • Tags / Fusion Proteins
    • ER Signal Exon 1 (N terminal on insert)
    • ER Signal Exon 2 (N terminal on insert)
    • ER Retention Signal (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ER-CanlonicSF was a gift from Alejandro San Martín (Addgene plasmid # 178343 ; http://n2t.net/addgene:178343 ; RRID:Addgene_178343)

  • For your References section:

    Single-Fluorophore Indicator to Explore Cellular and Sub-cellular Lactate Dynamics. Aburto C, Galaz A, Bernier A, Sandoval PY, Holtheuer-Gallardo S, Ruminot I, Soto-Ojeda I, Hertenstein H, Schweizer JA, Schirmeier S, Pastor TP, Mardones GA, Barros LF, San Martin A. ACS Sens. 2022 Oct 28. doi: 10.1021/acssensors.2c00731. 10.1021/acssensors.2c00731 PubMed 36306435
Related items:
Commonly requested with: