Skip to main content
Addgene

CanlonicSF
(Plasmid #178342)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178342 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1(-)GW
  • Backbone manufacturer
    In house
  • Backbone size w/o insert (bp) 5470
  • Total vector size (bp) 7227
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CanlonicSF
  • Alt name
    Calcium-and-Lactate Optical Nano-Indicator from CECs Single Fluorophore
  • Species
    Synthetic
  • Insert Size (bp)
    1757
  • Promoter CMV

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CanlonicSF was a gift from Alejandro San Martín (Addgene plasmid # 178342 ; http://n2t.net/addgene:178342 ; RRID:Addgene_178342)
  • For your References section:

    Single-Fluorophore Indicator to Explore Cellular and Sub-cellular Lactate Dynamics. Aburto C, Galaz A, Bernier A, Sandoval PY, Holtheuer-Gallardo S, Ruminot I, Soto-Ojeda I, Hertenstein H, Schweizer JA, Schirmeier S, Pastor TP, Mardones GA, Barros LF, San Martin A. ACS Sens. 2022 Oct 28. doi: 10.1021/acssensors.2c00731. 10.1021/acssensors.2c00731 PubMed 36306435