Skip to main content
Addgene

MLRV3:HRE-P53-MAPK/JNK-FOXO-TGFβ
(Plasmid #178320)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178320 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Omega Destination-CMV:ELuc:bgH
  • Backbone manufacturer
    Venken Lab, #124528
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 13678
  • Vector type
    Mammalian Expression, Luciferase, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    HRE RedFirefly reporter
  • Alt name
    Transcription Blocker + 4 copies of the HRE DNA binding motif + miniP, RedFirefly Luciferase
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2256

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer actccacccattgacgtcaatggaaag
  • 3′ sequencing primer agaatggcgccgggcctttc
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    P53 FLuc reporter
  • Alt name
    Transcription Blocker + 2 copies of the P53 DNA binding motif + miniP, Firefly Luciferase
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2218

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer caagaagcccgtggccaagatg
  • 3′ sequencing primer cggggtcataaaccttggaagtcattg
    • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    AP-1 Renilla reporter
  • Alt name
    Transcription Blocker + 6 copies of the AP-1 DNA binding motif + miniP, Renilla Luciferase
  • Insert Size (bp)
    1518

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer agggcggaaagatcgccgtg
  • 3′ sequencing primer CGAAGTCCTCCAAGGTAAACACCATTG
    • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    FOXO NLuc Reporter
  • Alt name
    Transcription Blocker + 3 copies of the DBE DNA binding motif + miniP, NLuc Luciferase
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1123

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GTCCTGAAGAACGAACAGTGAGCTTC
  • 3′ sequencing primer CTGGGTCGTAGACTTTGGAAGCC
    • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    SMAD GrRenilla reporter
  • Alt name
    Transcription Blocker + 7 copies of the SMAD DNA binding motif + miniP, Green Renilla Luciferase
  • Insert Size (bp)
    1552

Cloning Information for Gene/Insert 5

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAGGCTCTGCGAACGAATACTCG
  • 3′ sequencing primer ctt ttt acg gtt cct ggc ctt ttg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MLRV3:HRE-P53-MAPK/JNK-FOXO-TGFβ was a gift from Koen Venken (Addgene plasmid # 178320 ; http://n2t.net/addgene:178320 ; RRID:Addgene_178320)

  • For your References section:

    Synthetic Assembly DNA Cloning of Multiplex Hextuple Luciferase Reporter Plasmids. Sarrion-Perdigones A, Gonzalez Y, Venken KJT. Methods Mol Biol. 2022;2524:409-432. doi: 10.1007/978-1-0716-2453-1_32. 10.1007/978-1-0716-2453-1_32 PubMed 35821490
Related items:
Commonly requested with: