Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXCX-sGFAP-DLDH-IRES-tdTomato
(Plasmid #178311)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178311 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pXCX
  • Backbone size w/o insert (bp) 11870
  • Total vector size (bp) 12872
  • Vector type
    Mammalian Expression, Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    D-lactate dehydrogenase
  • Alt name
    DLDH
  • Species
    Synthetic
  • Insert Size (bp)
    1002
  • GenBank ID
    WP013438907
  • Promoter sGFAP
  • Tag / Fusion Protein
    • tdTomato (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer IREs forward (CCACTCATCTTATAGCTTTC)
  • 3′ sequencing primer IRES reverse (CCAAGTCAGTGGCTGCAC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXCX-sGFAP-DLDH-IRES-tdTomato was a gift from Sergey Kasparov (Addgene plasmid # 178311 ; http://n2t.net/addgene:178311 ; RRID:Addgene_178311)
  • For your References section:

    Expression of Microbial Enzymes in Mammalian Astrocytes to Modulate Lactate Release. Vaccari Cardoso B, Barrera I, Mosienko V, Gourine AV, Kasparov S, Teschemacher AG. Brain Sci. 2021 Aug 10;11(8). pii: brainsci11081056. doi: 10.3390/brainsci11081056. 10.3390/brainsci11081056 PubMed 34439675