pLKO_C.Ollas.V5_mCherry-NLS
(Plasmid
#178254)
-
PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO
- Backbone size w/o insert (bp) 9000
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenPC Tagged mCherry-NLS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1000
- Promoter eF1a
-
Tags
/ Fusion Proteins
- C.Ollas.V5 (N terminal on insert)
- Nuclear Localization Signal (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer cctttttgagtttggatcttggttcat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.07.13.451021v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO_C.Ollas.V5_mCherry-NLS was a gift from Brian Brown (Addgene plasmid # 178254 ; http://n2t.net/addgene:178254 ; RRID:Addgene_178254) -
For your References section:
Spatial CRISPR genomics identifies regulators of the tumor microenvironment. Dhainaut M, Rose SA, Akturk G, Wroblewska A, Nielsen SR, Park ES, Buckup M, Roudko V, Pia L, Sweeney R, Le Berichel J, Wilk CM, Bektesevic A, Lee BH, Bhardwaj N, Rahman AH, Baccarini A, Gnjatic S, Pe'er D, Merad M, Brown BD. Cell. 2022 Mar 10. pii: S0092-8674(22)00195-7. doi: 10.1016/j.cell.2022.02.015. 10.1016/j.cell.2022.02.015 PubMed 35290801