Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO_AU1.C.HSV_mCherry-NLS
(Plasmid #178210)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178210 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO
  • Backbone size w/o insert (bp) 9000
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nPC Tagged mCherry-NLS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1000
  • Promoter eF1a
  • Tags / Fusion Proteins
    • AU1.C.HSV (N terminal on insert)
    • Nuclear Localization Signal (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer cctttttgagtttggatcttggttcat
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO_AU1.C.HSV_mCherry-NLS was a gift from Brian Brown (Addgene plasmid # 178210 ; http://n2t.net/addgene:178210 ; RRID:Addgene_178210)
  • For your References section:

    Spatial CRISPR genomics identifies regulators of the tumor microenvironment. Dhainaut M, Rose SA, Akturk G, Wroblewska A, Nielsen SR, Park ES, Buckup M, Roudko V, Pia L, Sweeney R, Le Berichel J, Wilk CM, Bektesevic A, Lee BH, Bhardwaj N, Rahman AH, Baccarini A, Gnjatic S, Pe'er D, Merad M, Brown BD. Cell. 2022 Mar 10. pii: S0092-8674(22)00195-7. doi: 10.1016/j.cell.2022.02.015. 10.1016/j.cell.2022.02.015 PubMed 35290801