pGL3-mBcl11b-MAR4
(Plasmid
#178188)
-
PurposeLucifease reporter driven by MAR4 regulatory sequences of mouse Bcl11b
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178188 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepGL3-promoter
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5010
- Total vector size (bp) 5405
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBcl11b MAR4
-
Alt nameCtip2 MAR4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)420
-
GenBank IDNM_001286343.1
- Promoter SV40 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer RVprimer3 CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer GLprimer2 CTTTATGTTTTTGGCGTCTTCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-mBcl11b-MAR4 was a gift from Katsuhiko Ono (Addgene plasmid # 178188 ; http://n2t.net/addgene:178188 ; RRID:Addgene_178188) -
For your References section:
Species-Specific Mechanisms of Neuron Subtype Specification Reveal Evolutionary Plasticity of Amniote Brain Development. Nomura T, Yamashita W, Gotoh H, Ono K. Cell Rep. 2018 Mar 20;22(12):3142-3151. doi: 10.1016/j.celrep.2018.02.086. 10.1016/j.celrep.2018.02.086 PubMed 29562171
Map uploaded by the depositor.
