pKAN43Ag8-GFP
(Plasmid #178182)

• Purpose: Plant binary vector expressing GFP by a enhanced 35S promoter
• Depositing Lab: Keiichi Shimizu
• Publication: Binary plant vector expressing GFP driven by enhanced 35S promoter (unpublished)

Backbone

• Vector backbone: pKAN43Ag8
• Backbone size w/o insert (bp): 10232
• Total vector size (bp): 10952
• Vector type: Plant Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Selection with ampicillin tends to produce satellite colonies, so selection with 100 mg/l carbenicillin is recommended.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• Insert Size (bp): 720
• Mutation: The CAT is inserted after the start codon.
• GenBank ID:
• Entrez Gene: eGFP (a.k.a. pPRS3a_01)
• Promoter: The minimal 35S promoter from Cauliflower Mosaic Virus and the tetramer of its enhancer region.

Cloning Information

• Cloning method: Other
• 5′ sequencing primer: TTCGcaagacccttcctcta
• 3′ sequencing primer: CCAACAAAACATTCACAATGG

Resource Information

• Supplemental Documents:
  • pKAN43Ag8-GFP for Addgene.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

The kanamycin resistance gene in this vector has base substitutions compared to the original sequence, but this is not a problem for selection in plants. The NdeI site of pVS1 in this vector is deleted due to mutation, but this has not caused any problems with growth in bacteria or transformation into plants.