hME-pOX
(Plasmid
#178181)
-
PurposeProduce cRNA that expresses a human MCU-EMRE fusion protein in Xenopus oocytes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178181 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepOX
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 4000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman MCU-EMRE fusion protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1328
-
GenBank ID
-
Tag
/ Fusion Protein
- 1D4 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer T3
- 3′ sequencing primer AGTGGTAACCAGATCCTCGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hME-pOX was a gift from Ming-Feng Tsai (Addgene plasmid # 178181 ; http://n2t.net/addgene:178181 ; RRID:Addgene_178181) -
For your References section:
Quantitative assays to measure the transport activity of the mitochondrial calcium uniporter in cell lines or Xenopus oocytes. Rodriguez MX, Van Keuren AM, Tsai MF. STAR Protoc. 2021 Nov 23;2(4):100979. doi: 10.1016/j.xpro.2021.100979. eCollection 2021 Dec 17. 10.1016/j.xpro.2021.100979 PubMed 34877549