Skip to main content
Addgene

ATP1A1_G8_Dual_sgRNA
(Plasmid #178104)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178104 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 3087
  • Vector type
    Mammalian Expression, CRISPR ; Prime editing

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP1A1 G8 sgRNA + user-specified sgRNA
  • gRNA/shRNA sequence
    GCAGTGCCCAAGTCAATGCAG
  • Promoter Tandem U6 promoters

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
  • 3′ sequencing primer TGAGCGAGGAAGCGGAAGAG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

U6-sgRNA cassette derived from pX330-U6-Chimeric_BB-CBh-hSpCas9. New user-specified sgRNA can be cloned using the BbsI sites. This vector can be used for prime editing (PE3 nick sgRNAs) to co-target ATP1A1 (T804N) and a gene of interest. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ATP1A1_G8_Dual_sgRNA was a gift from Yannick Doyon (Addgene plasmid # 178104 ; http://n2t.net/addgene:178104 ; RRID:Addgene_178104)

  • For your References section:

    Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338
Related items:
Commonly requested with: