Skip to main content
Addgene

eSpCas9(1.1)_No_FLAG_NPM1_G6
(Plasmid #178091)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178091 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Total vector size (bp) 8439
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NPM1 G6 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
  • gRNA/shRNA sequence
    GGGGTCTATATATAAGCGCG
  • Species
    H. sapiens (human)
  • Promoter U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is derived from eSpCas9(1.1) (Plasmid #71814) from Feng Zhang's lab. The 3x FLAG sequence was removed to prevent interference of the tag in western blot and immunoprecipitation applications. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9(1.1)_No_FLAG_NPM1_G6 was a gift from Yannick Doyon (Addgene plasmid # 178091 ; http://n2t.net/addgene:178091 ; RRID:Addgene_178091)

  • For your References section:

    Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338
Related items:
Commonly requested with: