AAVS1_Puro_hPGK1_EGFP_Donor
(Plasmid #178088)

• Purpose: HDR donor plasmid to introduce the EGFP cassette to AAVS1 using AAVS1 T2 sgRNA.
• Depositing Lab: Yannick Doyon
• Publication: Levesque et al Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z.

Backbone

• Vector backbone: pUC19
• Total vector size (bp): 6449
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• Species: H. sapiens (human)
• Promoter: Human PGK1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: SbfI (not destroyed)
• 5′ sequencing primer: TAGTGTGGGCCCTGTTCCTG
• 3′ sequencing primer: GAGGGGCAAACAACAGATGG

Resource Information

• Supplemental Documents:
  • AAVS1_Puro_hPGK1_EGFP_Donor Copy.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid derived from AAVS1_Puro_PGK1_3xFLAG_Twin_Strep (Addgene 68375). Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.