pAAV-cFos-XRI-V5
(Plasmid
#178058)
-
PurposeExpression Recording Islands (XRIs) for recording cellular physiological histories along intracellular protein self-assembly. Contains XRI subunit with V5 tag, under c-fos promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178058 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-cFos
-
Backbone manufacturerEpoch Life Science, Inc.
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXRI-V5
-
Alt name1POK(E239Y)-Linker25-V5-Linker3-MBP tag
-
SpeciesSynthetic
-
Insert Size (bp)2394
- Promoter Mouse c-fos promoter
-
Tag
/ Fusion Protein
- V5-MBP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGCGCAGATCGATAACTAGTGC
- 3′ sequencing primer GCAAACAACAGATGGCTGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.10.13.464006v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-cFos-XRI-V5 was a gift from Edward Boyden (Addgene plasmid # 178058 ; http://n2t.net/addgene:178058 ; RRID:Addgene_178058) -
For your References section:
Recording of cellular physiological histories along optically readable self-assembling protein chains. Linghu C, An B, Shpokayte M, Celiker OT, Shmoel N, Zhang R, Zhang C, Park D, Park WM, Ramirez S, Boyden ES. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01586-7. 10.1038/s41587-022-01586-7 PubMed 36593405