pET28a Cdk2ap1CAN
(Plasmid #178032)

• Purpose: Expression vector for the purpose of protein purification.
• Depositing Lab: Lin He
• Publication: Modzelewski et al Cell. 2021 Oct 7. pii: S0092-8674(21)01104-1. doi: 10.1016/j.cell.2021.09.021.

Backbone

• Vector backbone: pET28a
• Backbone manufacturer: EMD Biosciences
• Backbone size w/o insert (bp): 5369
• Total vector size (bp): 6868
• Vector type: Bacterial Expression ; Nonviral

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cdk2ap1
• Species: M. musculus (mouse)
• Insert Size (bp): 1499
• GenBank ID: 13445 13445
• Entrez Gene: Cdk2ap1 (a.k.a. Apc10, Cdkap1, DORC1, Doc1, ST19, doc-1, p12)
• Promoter: T7LacI
• Tag / Fusion Protein:
  • 6xHIS - Thrombin - MBP- TEV-TRS (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NDE1 (not destroyed)
• 3′ cloning site: XHOI (not destroyed)
• 5′ sequencing primer: ggggaattgtgagcggataac
• 3′ sequencing primer: gccaactcagcttcctttcg

Resource Information

• Supplemental Documents:
  • pET28a Cdk2ap1CAN .gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry