pLentiCRISPRv1_SDHA
(Plasmid
#177980)
-
Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHA
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177980 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLentiCRISPR v1
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting SDHA
-
gRNA/shRNA sequenceACCGTGCATTATAACATGGG
-
SpeciesH. sapiens (human)
-
MutationN/A
-
Entrez GeneSDHA (a.k.a. CMD1GG, FP, MC2DN1, NDAXOA, PGL5, PPGL5, SDH1, SDH2, SDHF)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (destroyed during cloning)
- 3′ cloning site Unknown (destroyed during cloning)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv1_SDHA was a gift from David Sabatini & Jessica Spinelli (Addgene plasmid # 177980 ; http://n2t.net/addgene:177980 ; RRID:Addgene_177980) -
For your References section:
Fumarate is a terminal electron acceptor in the mammalian electron transport chain. Spinelli JB, Rosen PC, Sprenger HG, Puszynska AM, Mann JL, Roessler JM, Cangelosi AL, Henne A, Condon KJ, Zhang T, Kunchok T, Lewis CA, Chandel NS, Sabatini DM. Science. 2021 Dec 3;374(6572):1227-1237. doi: 10.1126/science.abi7495. Epub 2021 Dec 2. 10.1126/science.abi7495 PubMed 34855504