Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p2B-57
(Plasmid #177927)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177927 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS426
  • Backbone size w/o insert (bp) 5726
  • Total vector size (bp) 7025
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EGFP
  • Alt name
    pTET3_yeGFP
  • Species
    Synthetic
  • Insert Size (bp)
    1305
  • Promoter TET3 (contains three rtTA binding sites)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTAATACGACTCACTATAG
  • 3′ sequencing primer CAATTAACCCTCACTAAAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Mads Kaern (University of Ottawa) kindly provided DNA sequences to design the inserts, as described in Roney et al. 2016 Sci Rep.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please refer to Roney et al. 2016 Sci Rep. "Improvement of the reverse tetracycline transactivator by single amino acid substitutions that reduce leaky target gene expression to undetectable levels" (doi: 10.1038/srep27697) for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2B-57 was a gift from Vadim Gladyshev (Addgene plasmid # 177927 ; http://n2t.net/addgene:177927 ; RRID:Addgene_177927)