p2B-56
(Plasmid #177925)

• Purpose: Expresses optimized unleaky reverse tetracycline transactivator (rtTA-M2-SE-G72P) under control of yeast MYO2 promoter
• Depositing Lab: Vadim Gladyshev
• Publication: Barre et al (unpublished)

Backbone

• Vector backbone: pRS426
• Backbone size w/o insert (bp): 5726
• Total vector size (bp): 7425
• Vector type: Bacterial Expression, Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Optimized unleaky reverse tetracycline transactivator (rtTA-M2-SE-G72P) under control of yeast MYO2 promoter
• Alt name: pMYO2_rtTA-M2-SE-G72P
• Species: S. cerevisiae (budding yeast); Bacteria
• Insert Size (bp): 1705
• Mutation: V9I; F67S; G72P, F86Y; R171K
• Promoter: MYO2

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGTAATACGACTCACTATAG
• 3′ sequencing primer: CAATTAACCCTCACTAAAGG

Resource Information

• Supplemental Documents:
  • p2B56.gb
• A portion of this plasmid was derived from a plasmid made by: Mads Kaern (University of Ottawa) kindly provided DNA sequences to design the inserts, as described in Roney et al. 2016 Sci Rep.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please refer to Roney et al. 2016 Sci Rep. "Improvement of the reverse tetracycline transactivator by single amino acid substitutions that reduce leaky target gene expression to undetectable levels" (doi: 10.1038/srep27697) for more information.