Skip to main content
Addgene

pET28a(CTLA4)
(Plasmid #177905)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177905 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28A
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CTLA4 (aa 183-223 only)
  • Species
    H. sapiens (human)
  • Entrez Gene
    CTLA4 (a.k.a. ALPS5, CD, CD152, CELIAC3, CTLA-4, GRD4, GSE, IDDM12)
  • Promoter T7
  • Tag / Fusion Protein
    • 10xHis-Thrombin cut site-T7 tag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a(CTLA4) was a gift from Ron Vale (Addgene plasmid # 177905 ; http://n2t.net/addgene:177905 ; RRID:Addgene_177905)
  • For your References section:

    T cell costimulatory receptor CD28 is a primary target for PD-1-mediated inhibition. Hui E, Cheung J, Zhu J, Su X, Taylor MJ, Wallweber HA, Sasmal DK, Huang J, Kim JM, Mellman I, Vale RD. Science. 2017 Mar 31;355(6332):1428-1433. doi: 10.1126/science.aaf1292. Epub 2017 Mar 9. 10.1126/science.aaf1292 PubMed 28280247