Skip to main content
Addgene

pFastBac (GST-SNAP-Shp2)
(Plasmid #177897)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177897 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFastBacHT
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Shp2
  • Species
    H. sapiens (human)
  • Entrez Gene
    PTPN11 (a.k.a. BPTP3, CFC, JMML, METCDS, NS1, PTP-1D, PTP2C, SH-PTP2, SH-PTP3, SHP2)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • TEV-GST-PreScission cut site-SNAP tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer GGATTATTCATACCGTCCCA
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac (GST-SNAP-Shp2) was a gift from Ron Vale (Addgene plasmid # 177897 ; http://n2t.net/addgene:177897 ; RRID:Addgene_177897)
  • For your References section:

    T cell costimulatory receptor CD28 is a primary target for PD-1-mediated inhibition. Hui E, Cheung J, Zhu J, Su X, Taylor MJ, Wallweber HA, Sasmal DK, Huang J, Kim JM, Mellman I, Vale RD. Science. 2017 Mar 31;355(6332):1428-1433. doi: 10.1126/science.aaf1292. Epub 2017 Mar 9. 10.1126/science.aaf1292 PubMed 28280247