pFastBacHT (His10-4xFRB-SNAP-Lck G2A)
(Plasmid
#177887)
-
PurposeBaculo expression of decahistidine tag fused to 4xFRB, 1xSNAP tag and human Lck G2A
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBacHT
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLck
-
SpeciesH. sapiens (human)
-
MutationG2A
-
Entrez GeneLCK (a.k.a. IMD22, LSK, YT16, p56lck, pp58lck)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- 10xHis-TEV-4xFRB-SNAP tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer GGATTATTCATACCGTCCCA
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBacHT (His10-4xFRB-SNAP-Lck G2A) was a gift from Ron Vale (Addgene plasmid # 177887 ; http://n2t.net/addgene:177887 ; RRID:Addgene_177887) -
For your References section:
In vitro membrane reconstitution of the T-cell receptor proximal signaling network. Hui E, Vale RD. Nat Struct Mol Biol. 2014 Feb;21(2):133-42. doi: 10.1038/nsmb.2762. Epub 2014 Jan 26. 10.1038/nsmb.2762 PubMed 24463463