pYL-kasOp-FnCas12a2
(Plasmid
#177874)
-
PurposeExpresses Streptomyces codon optimized FnCas12a. Used to modify genome of Streptomyces.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCRISPomyces-2
- Backbone size w/o insert (bp) -1
-
Vector typeCRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameStreptomyces codon optimized FnCas12a
-
Alt nameFnCas12a
-
Alt nameFnCpf1
-
SpeciesStreptomyces
-
Insert Size (bp)3909
- Promoter kasOp*
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCGAACAGGCCATTCACAGA
- 3′ sequencing primer TCTGACGCTCAGTGGAACGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYL-kasOp-FnCas12a2 was a gift from Yunzi Luo (Addgene plasmid # 177874 ; http://n2t.net/addgene:177874 ; RRID:Addgene_177874) -
For your References section:
Efficient Multiplex Genome Editing in Streptomyces via Engineered CRISPR-Cas12a Systems. Zhang J, Zhang D, Zhu J, Liu H, Liang S, Luo Y. Front Bioeng Biotechnol. 2020 Jun 30;8:726. doi: 10.3389/fbioe.2020.00726. eCollection 2020. 10.3389/fbioe.2020.00726 PubMed 32695773