Skip to main content
Addgene

pFAST-BAC BAF57/SMARCE1-His
(Plasmid #177861)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177861 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pFAST BAC1
  • Backbone size w/o insert (bp) 4775
  • Total vector size (bp) 6100
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SMARCE1
  • Alt name
    BAF57
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1356
  • Entrez Gene
    SMARCE1 (a.k.a. BAF57, CSS5)
  • Promoter polyhedrin
  • Tag / Fusion Protein
    • His tag at C-terminus with GGGGS linker (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer pFAST-BAC seq-Fw: aaatgataaccatctcgc
  • 3′ sequencing primer pFAST-BAC seq-Rv: tgtttcaggttcagggggag
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Condon optimized and synthesized by IDTDNA

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFAST-BAC BAF57/SMARCE1-His was a gift from Yoshihiro Izumiya (Addgene plasmid # 177861 ; http://n2t.net/addgene:177861 ; RRID:Addgene_177861)

  • For your References section:

    KSHV transactivator-derived small peptide traps coactivators to attenuate MYC and inhibits leukemia and lymphoma cell growth. Shimoda M, Lyu Y, Wang KH, Kumar A, Miura H, Meckler JF, Davis RR, Chantarasrivong C, Izumiya C, Tepper CG, Nakajima KI, Tuscano J, Barisone G, Izumiya Y. Commun Biol. 2021 Dec 2;4(1):1330. doi: 10.1038/s42003-021-02853-0. 10.1038/s42003-021-02853-0 PubMed 34857874
Related items:
Commonly requested with: