ptia1l-hsp-GFP
(Plasmid
#177837)
-
PurposeDonor plasmid for knock-in of hsp70-EGFP using CRISPR-Cas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCR2.1-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3931
- Total vector size (bp) 6637
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametia1l-sgRNA target site-hsp70-EGFP
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)2705
- Promoter hsp70
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer CAGGAAACAGCTATGACCATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The tia1l sgRNA was designed and published by Hwang et al., 2013, Nature Biotechnology: https://pubmed.ncbi.nlm.nih.gov/23360964/.
The strategy is based on a method described by Lackner et al. 2015, Nature Communications: https://pubmed.ncbi.nlm.nih.gov/26674669/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ptia1l-hsp-GFP was a gift from David Kingsley (Addgene plasmid # 177837 ; http://n2t.net/addgene:177837 ; RRID:Addgene_177837) -
For your References section:
Evolution of stickleback spines through independent cis-regulatory changes at HOXDB. Wucherpfennig JI, Howes TR, Au JN, Au EH, Roberts Kingman GA, Brady SD, Herbert AL, Reimchen TE, Bell MA, Lowe CB, Dalziel AC, Kingsley DM. Nat Ecol Evol. 2022 Sep 1. pii: 10.1038/s41559-022-01855-3. doi: 10.1038/s41559-022-01855-3. 10.1038/s41559-022-01855-3 PubMed 36050398