pMax_GFP_C289T
(Plasmid #177826)

• Purpose: Site-specific mutagenesis of GFP for the purposes of creating a site-specific hypoxanthine lesion for the purposes of measuring MPG activity via Host Cell Reactivation (HCR).
• Depositing Labs: Zachary Nagel, Leona Samson
• Publication: Nagel et al Proc Natl Acad Sci U S A. 2014 May 6;111(18):E1823-32. doi: 10.1073/pnas.1401182111. Epub 2014 Apr 22.

Backbone

• Vector backbone: pMax
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP_C289T
• Species: Synthetic
• Insert Size (bp): 720
• Mutation: C289T
• Promoter: CMV

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GCAATAGCATCACAAATTTCACA

Resource Information

• Supplemental Documents:
  • pmax_GFP_C289T.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information, see Chaim et al. 2017 PNAS (doi: 10.1073/pnas.1712032114) and Piett, Pecen et al. 2021 Nat Protoc. (doi: 10.1038/s41596-021-00577-3).