Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMax_GFP
(Plasmid #177825)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177825 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMax
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Promoter CMV

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GCAATAGCATCACAAATTTCACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information, see Piett, Pecen et al. 2021 Nat Protoc. (doi: 10.1038/s41596-021-00577-3).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMax_GFP was a gift from Zachary Nagel & Leona Samson (Addgene plasmid # 177825 ; http://n2t.net/addgene:177825 ; RRID:Addgene_177825)
  • For your References section:

    Multiplexed DNA repair assays for multiple lesions and multiple doses via transcription inhibition and transcriptional mutagenesis. Nagel ZD, Margulies CM, Chaim IA, McRee SK, Mazzucato P, Ahmad A, Abo RP, Butty VL, Forget AL, Samson LD. Proc Natl Acad Sci U S A. 2014 May 6;111(18):E1823-32. doi: 10.1073/pnas.1401182111. Epub 2014 Apr 22. 10.1073/pnas.1401182111 PubMed 24757057