pLV-hSyn1-GFP
(Plasmid #177810)

• Purpose: Encodes a GFP driven by human synapsin I promoter
• Depositing Lab: Christopher Grigsby
• Publication: Mattiassi et al Biomater Sci. 2021 Aug 7;9(15):5175-5191. doi: 10.1039/d1bm00400j. Epub 2021 Jun 15.

Backbone

• Vector backbone: pLV
• Backbone size w/o insert (bp): 8500
• Total vector size (bp): 9210
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CopGFP inserted behind human synapsin I promoter
• Alt name: SYN1
• Species: H. sapiens (human)
• Insert Size (bp): 699
• Entrez Gene: SYN1 (a.k.a. EPILX, EPILX1, MRX50, SYN1a, SYN1b, SYNI)
• Promoter: Syn1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: PmeI (destroyed during cloning)
• 5′ sequencing primer: agtcgtgtcgtgcctgagag
• 3′ sequencing primer: tgttgctccttttacgctatg

Resource Information

• Supplemental Documents:
  • pLV-Syn1-GFP.gbk
• A portion of this plasmid was derived from a plasmid made by: Vector derived from pLV-hSyn-RFP (Addgene Plasmid #22909)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry