pJH3971
(Plasmid
#177736)
-
PurposePrgef-1 GCaMP6::3xNLS::mNeptune
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177736 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepBSK
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP
-
SpeciesSynthetic
- Promoter Prgef-1
-
Tag
/ Fusion Protein
- mNeptune (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer TAGCGTCGACGGATCCAAAAA
- 3′ sequencing primer GGAGGACGTGGAGGATCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH3971 was a gift from Mei Zhen (Addgene plasmid # 177736 ; http://n2t.net/addgene:177736 ; RRID:Addgene_177736) -
For your References section:
Natural sensory context drives diverse brain-wide activity during C. elegans mating. Susoy V, Hung W, Witvliet D, Whitener JE, Wu M, Park CF, Graham BJ, Zhen M, Venkatachalam V, Samuel ADT. Cell. 2021 Sep 30;184(20):5122-5137.e17. doi: 10.1016/j.cell.2021.08.024. Epub 2021 Sep 16. 10.1016/j.cell.2021.08.024 PubMed 34534446