Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

YN2_1_LT84_RPL13A
(Plasmid #177712)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177712 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Empty backbone
  • Total vector size (bp) 9423
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • gRNA/shRNA sequence
    GAAGGAAAATACAAAAATTG
  • Species
    S. cerevisiae (budding yeast)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    YN2_1_LT84_RPL13A was a gift from Lisbeth Olsson (Addgene plasmid # 177712 ; http://n2t.net/addgene:177712 ; RRID:Addgene_177712)
  • For your References section:

    Real-Time Monitoring of the Yeast Intracellular State During Bioprocesses With a Toolbox of Biosensors. Torello Pianale L, Rugbjerg P, Olsson L. Front Microbiol. 2022 Jan 7;12:802169. doi: 10.3389/fmicb.2021.802169. eCollection 2021. 10.3389/fmicb.2021.802169 PubMed 35069506