pDIV537
(Plasmid #177704)

• Purpose: Plasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hansenii
• Depositing Lab: Uffe Mortensen
• Publication: Strucko et al Synth Biol (Oxf). 2021 Oct 12;6(1):ysab031. doi: 10.1093/synbio/ysab031. eCollection 2021.

Backbone

• Vector backbone: pDIV066
• Total vector size (bp): 11829
• Vector type: Bacterial Expression, Yeast Expression, CRISPR
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cas9
• Species: CTG-clade compatible
• Promoter: RNR2p (Debaryomyces hansenii )
• Tag / Fusion Protein:
  • SV40 (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CTATGGCTCCAGGTCCCGAG

Gene/Insert 2

• Gene/Insert name: Nat
• Species: CTG-clade compatible
• Promoter: TDH3p (Candida lusitaniae)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GCTTGAGAAGGTTTTGGGACG

Gene/Insert 3

• Gene/Insert name: tRNA-sgRNA-tRNA
• Alt name: sgRNA Targeting KU70 homolog in D.hansenii: aCTGCTTCtTCATTCAATTC
• Species: Synthetic; CTG-Clade compatible
• Promoter: TEF1p (Debaryomyces hansenii)

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: CTAGAAAGTATAGGAACTTCTGAAGTGG

Resource Information

• Supplemental Documents:
  • pDIV537-CRISPR-tRNA-sgRNA_KU70 (pDIV489) currated.gbk
• A portion of this plasmid was derived from a plasmid made by: Codon optimized Cas9 was derived from another plasmid pRB732 that was obtained from Prof. Richard J. Bennett

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry