pAAV-nEF-Coff/Fon DREADD Gi-mCherry
(Plasmid #177669)

• Purpose: Expresses DREADD Gi only in Flp expressing cells and not in Cre expressing cells
• Depositing Lab: Karl Deisseroth
• Publication: Knoedler et al Cell. 2022 Feb 17;185(4):654-671.e22. doi: 10.1016/j.cell.2021.12.031. Epub 2022 Jan 21.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4591
• Total vector size (bp): 7487
• Modifications to backbone: None
• Vector type: Mammalian Expression, Mouse Targeting, AAV, Cre/Lox ; INTRSECT

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DREADD Gi-mCherry
• Alt name: hM4Gi-mCherry
• Species: Synthetic
• Insert Size (bp): 2882
• Promoter: nEF
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GTTTAAAGCTCAGGTCGAGA
• 3′ sequencing primer: GAATACCAGTCAATCTTTCAC

Resource Information

• Supplemental Documents:
  • pAAV-nEF-CoffFon-DREADD Gi-mCherry-WPRE.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry