pT7C-DNAJB4
(Plasmid #177656)

• Purpose: Recombinant protein synthesis of human DNAJB4
• Depositing Lab: Jeff Kuret
• Publication: Ayoub et al PLoS Genet. 2023 Mar 27;19(3):e1010681. doi: 10.1371/journal.pgen.1010681. eCollection 2023 Mar.

Backbone

• Vector backbone: pT7C
• Backbone size w/o insert (bp): 3352
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: To produce protein, express in BL21(DE3) Codon Plus RIL. Purify by Ni IMAC and SEC.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: DNAJB4
• Alt name: NP_008965.2
• Alt name: DNAJB4 Isoform A
• Species: H. sapiens (human)
• Insert Size (bp): 1014
• Entrez Gene: DNAJB4 (a.k.a. DNAJW, DjB4, HLJ1)
• Promoter: T7
• Tag / Fusion Protein:
  • 6xHis-Thrombin (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GATTATCAACCGGGGTGGCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Genes were cloned from a cDNA library and may contain silent mutations. However, all inserts were sequence-verified and any nucleotide changes were mutagenized to encode the consensus amino acid sequence.