pT7II-2N4Rtau
(Plasmid #177653)

• Purpose: Recombinant protein synthesis of human Tau
• Depositing Lab: Jeff Kuret
• Publication: Ayoub et al PLoS Genet. 2023 Mar 27;19(3):e1010681. doi: 10.1371/journal.pgen.1010681. eCollection 2023 Mar.

Backbone

• Vector backbone: pT7II
• Backbone size w/o insert (bp): 3256
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: To produce tau protein, express in BL21(DE3) Codon Plus RP. Purify by Ni IMAC and SEC.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Tau (2N4R)
• Alt name: NP_005901.2
• Alt name: MAPT Isoform 2
• Species: H. sapiens (human)
• Insert Size (bp): 1326
• Entrez Gene: MAPT (a.k.a. DDPAC, FTD1, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU, Tau-PHF6, tau-40)
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GATTATCAACCGGGGTGGCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Genes were cloned from a cDNA library and may contain silent mutations. However, all inserts were sequence-verified and any nucleotide changes were mutagenized to encode the consensus amino acid sequence.