Skip to main content
Addgene

pAAV-hSyn-SOUL-P2A-TdTomato-WPRE-hGH-polyA
(Plasmid #177576)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177576 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Total vector size (bp) 7061
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SOUL
  • Species
    Chlamydomonas reinhardtii
  • Insert Size (bp)
    927
  • Promoter hSyn
  • Tag / Fusion Protein
    • tdTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer gtctcagccatcgggtgtat
  • 3′ sequencing primer tacacccgatggctgagac
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SOUL is a combination of the stabilized step-function opsin (SSFO) mutations C128S and D156A with the T159C mutation in channelrhodopsin previously reported by Dr. Karl Deisseroth et. al.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-SOUL-P2A-TdTomato-WPRE-hGH-polyA was a gift from Guoping Feng (Addgene plasmid # 177576 ; http://n2t.net/addgene:177576 ; RRID:Addgene_177576)

  • For your References section:

    An Ultra-Sensitive Step-Function Opsin for Minimally Invasive Optogenetic Stimulation in Mice and Macaques. Gong X, Mendoza-Halliday D, Ting JT, Kaiser T, Sun X, Bastos AM, Wimmer RD, Guo B, Chen Q, Zhou Y, Pruner M, Wu CW, Park D, Deisseroth K, Barak B, Boyden ES, Miller EK, Halassa MM, Fu Z, Bi G, Desimone R, Feng G. Neuron. 2020 Jul 8;107(1):197. doi: 10.1016/j.neuron.2020.06.018. 10.1016/j.neuron.2020.06.018 PubMed 32645306
Related items:
Commonly requested with: