mCherry-PTDSS1-IRES-puromycin-pLVx-EF1a
(Plasmid #177435)

• Purpose: To express mCherry fused to PTDSS1, a protein that localized to mitochondria associated ER membranes (MAMs). Lentiviral vector used to make cell lines expressing this MAM landmark.
• Depositing Lab: David Andrews
• Publication: David Andrews Lab plasmids (unpublished)

Backbone

• Vector backbone: pLVX-EF1a-IRES-Puromycin
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Phosphatidylserine synthase-1, PTDSS1, LMHD, PSS1, PSSA
• Alt name: mCherry-PTDSS1, Ch-PTDSS1, ChPTDSS1
• Species: H. sapiens (human)
• Entrez Gene: PTDSS1 (a.k.a. LMHD, PSS1, PSSA)
• Promoter: EF1a
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: aagcgcgatcacatggtcctg

Resource Information

• Supplemental Documents:
  • mCherry-PTDSS1_IRES-Puromycin-pLVX-EF1a.gbk
• A portion of this plasmid was derived from a plasmid made by: PTDSS1 sequence matches Gene ID: 9791. mCherry sequence matches GenBank: AZP55984.1.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Infection with this plasmid will express mCherry-fused to the N-terminus of PTDSS1, a protein which localizes to mitochondria associated ER membranes. There is a flexible, 8 aa linker "SGLRSGTS", between mCherry and PTDSS1.