Venus-Bik-cb5-pEGFP-C1
(Plasmid #177431)

• Purpose: To express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with its membrane binding region (MBR) replaced with Cb5 targeting sequence. Swap made in original Addgene #166737.
• Depositing Lab: David Andrews
• Publication: David Andrews Lab plasmids (unpublished)

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bik, Bcl-2-interacting killer, or Apoptosis inducer NBK
• Alt name: VBik-Cb5, V-Bik-Cb5, Venus-Bik-Cb5
• Species: H. sapiens (human)
• Mutation: Bik MBR removed (after position 136) and replaced with Cb5
• Entrez Gene: BIK (a.k.a. BIP1, BP4, NBK)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-Bik-Cb5-pEGFP-C1.gbk
• A portion of this plasmid was derived from a plasmid made by: Bik sequence aligns with H. sapiens BCL2 interacting killer (BIK), mRNA; NCBI Reference Sequence: NM_001197.5 (aas 1-136), with tail of "cytochrome b5 [R. norvegicus]" see NCBI Reference Sequence: NP_071581.1. Venus sequence received from Dr. Ray Truant (McMaster University).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express Venus-fused to the N-terminus of Bik-Cb5. There is a flexible, 8 aa linker "SGLRSRGG", between Venus and Bik-Cb5. This Venus protein contains an F224R mutation to make it monomeric.