Venus-Bik-GG153AA-pEGFP-C1
(Plasmid #177427)

• Purpose: To express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with G153A,G154A mutations in membrane binding region. Mutations made to Addgene #166737.
• Depositing Lab: David Andrews
• Publication: David Andrews Lab plasmids (unpublished)

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bik, Bcl-2-interacting killer, or Apoptosis inducer NBK
• Alt name: VBik-GG153AA, V-Bik-GG153AA, Venus-Bik-GG153AA
• Species: H. sapiens (human)
• Mutation: Glycines 153 and 154 mutated to alanine
• Entrez Gene: BIK (a.k.a. BIP1, BP4, NBK)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-Bik-GG153AA-pEGFP-C1.gbk
• A portion of this plasmid was derived from a plasmid made by: Bik sequence aligns with H. sapiens BCL2 interacting killer (BIK), mRNA; NCBI Reference Sequence: NM_001197.5. Venus sequence received from Dr. Ray Truant (McMaster University).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express Venus-fused to the N-terminus of Bik-GG153AA. There is a flexible, 8 aa linker "SGLRSRGG", between Venus and Bik-GG153AA. This Venus protein contains an F224R mutation to make it monomeric.