mCerulean3-Bik-s2193
(Plasmid #177425)

• Purpose: To express mCerulean3 fused to the N-terminus of the Bcl-2 family protein, Bik, in a plasmid with Blasticidin resistance. Used to make stable BMK-DKO cell lines.
• Depositing Lab: David Andrews
• Publication: David Andrews Lab plasmids (unpublished)

Backbone

• Vector backbone: s2193
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Blasticidin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Bik, Bcl-2-interacting killer, or Apoptosis inducer NBK
• Alt name: CBik, mCerulean3-Bik, mCer3-Bik
• Species: H. sapiens (human)
• Entrez Gene: BIK (a.k.a. BIP1, BP4, NBK)
• Promoter: Human ferritin
• Tag / Fusion Protein:
  • mCerulean3 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: CCTTGAGTTTTGAGCGGAGCTAA
• 3′ sequencing primer: TTACCCCTCTAGACCTGGAAAG

Resource Information

• Supplemental Documents:
  • mCerulean3-Bik-s2193.gbk
• A portion of this plasmid was derived from a plasmid made by: Bik sequence aligns with H. sapiens BCL2 interacting killer (BIK), mRNA; NCBI Reference Sequence: NM_001197.5. mCerulean3 sequence received from Mark Rizzo PMID: 21479270.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bik. There is a flexible, 4 aa linker "SRGG", between mCerulean3 and Bik.