Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mCerulean3-Bik-s2193
(Plasmid #177425)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177425 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    s2193
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Blasticidin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Bik, Bcl-2-interacting killer, or Apoptosis inducer NBK
  • Alt name
    CBik, mCerulean3-Bik, mCer3-Bik
  • Species
    H. sapiens (human)
  • Entrez Gene
    BIK (a.k.a. BIP1, BP4, NBK)
  • Promoter Human ferritin
  • Tag / Fusion Protein
    • mCerulean3 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CCTTGAGTTTTGAGCGGAGCTAA
  • 3′ sequencing primer TTACCCCTCTAGACCTGGAAAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Bik sequence aligns with H. sapiens BCL2 interacting killer (BIK), mRNA; NCBI Reference Sequence: NM_001197.5. mCerulean3 sequence received from Mark Rizzo PMID: 21479270.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bik. There is a flexible, 4 aa linker "SRGG", between mCerulean3 and Bik.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCerulean3-Bik-s2193 was a gift from David Andrews (Addgene plasmid # 177425 ; http://n2t.net/addgene:177425 ; RRID:Addgene_177425)