Venus-30aa-Noxa-4E-pEGFP-C1
(Plasmid #177424)

• Purpose: To express Venus fused to Noxa-4E, with a longer linker sequence between compared to Addgene #166745.
• Depositing Lab: David Andrews
• Publication: David Andrews Lab plasmids (unpublished)

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Noxa, PMA-induced protein 1
• Alt name: Venus-Noxa-4E, V-Noxa-4E, VNoxa-4E
• Species: H. sapiens (human)
• Mutation: 4 hydrophobic residues in the BH3 region mutated to glutamic acid
• Entrez Gene: PMAIP1 (a.k.a. APR, NOXA)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-30aa-Noxa-4E-pEGFP-C1.gbk
• A portion of this plasmid was derived from a plasmid made by: Noxa sequence aligns with phorbol-12-myristate-13-acetate-induced protein 1 isoform 6 [H. sapiens] (NCBI Reference Sequence: NM_021127.3). Venus sequence received from Dr. Ray Truant (McMaster University).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express Venus-fused to the N-terminus of Noxa. Noxa BH3 region has hydrophobic positions H1-H4 mutated to glutamic acid (E), refered to as "BH3-4E" mutation, BH3 mutations: C25E, L29E, F32E, L36E. Linked by a 30 aa (aa) flexible linker, "SGLTSGALETRPGGTAGPVAGETRGRSRGG". This Venus protein contains an A207K, F224R and L232H mutations to make it monomeric. An additional A164V mutation in Venus occured in this construct, which does not appear to affect fluorescence of the protein.