Venus-Bcl2-cb5-pEGFP-C1
(Plasmid #177422)

• Purpose: To express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-Cb5: Bcl-2 with its membrane binding region swapped for Cb5 (ER targeting sequence).
• Depositing Lab: David Andrews
• Publication: David Andrews Lab plasmids (unpublished)

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bcl-2-Cb5, Bcl2-cb5, Bcl-cb5
• Alt name: VBcl2-Cb5, VBcl-2-Cb5, Venus-Bcl-2-Cb5
• Species: H. sapiens (human)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-Bcl2-cb5-pEGFP-C1
• A portion of this plasmid was derived from a plasmid made by: See PMID: 8861942 for description of chimera Bcl2-Cb5 (aka Bcl-Cb5). Venus sequence received from Dr. Ray Truant (McMaster University).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express Venus-fused to the N-terminus of Bcl-2-Cb5. There is a flexible, 5 aa linker "SGLRS", between Venus and Bcl2-Cb5. This Venus protein contains an F224R mutation to make it monomeric.