mCerulean3-Bcl2-ActA-s2193
(Plasmid #177420)

• Purpose: To express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-ActA: Bcl-2 with its membrane binding region swapped for ActA (mitochondrial targeting sequence).
• Depositing Lab: David Andrews
• Publication: David Andrews Lab plasmids (unpublished)

Backbone

• Vector backbone: s2193
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Blasticidin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Bcl-2-ActA, Bcl2-acta, Bcl-acta
• Alt name: CBcl2-ActA, CBcl-2-ActA, mCerulean3-Bcl-2-ActA, mCer3-Bcl2-ActA
• Species: H. sapiens (human)
• Promoter: Human ferritin
• Tag / Fusion Protein:
  • mCerulean3 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: CCTTGAGTTTTGAGCGGAGCTAA
• 3′ sequencing primer: TTACCCCTCTAGACCTGGAAAG

Resource Information

• Supplemental Documents:
  • mCerulean3-Bcl2-ActA-s2193.gbk
• A portion of this plasmid was derived from a plasmid made by: See PMID: 8861942 for description of chimera Bcl2-ActA (aka Bcl-ActA). mCerulean3 sequence received from Mark Rizzo PMID: 21479270.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bcl-2-ActA. There is a flexible, 7 aa linker "SGLRSTR", between mCerulean3 and Bcl-2-ActA.